La ciencia que hay detrás de la primera vacuna contra la COVID-19

Por Lluis Montoliu, el 27 diciembre, 2020. Categoría(s): genética ✎ 72
La vacuna contra la COVID-19 desarrollada por las empresas BioNtech y Pfizer es la primera que va a llegar a España. Fotografía: Reuters/BBC

Hoy, domingo 27 de diciembre de 2020, es el día en el que la primera vacuna aprobada contra la COVID-19, desarrollada por las empresas BioNtech y Pfizer, va a ser administrada por vez primera en España y en el resto de la Unión Europea, tras ser autorizada en el Reino Unido, EE.UU., la Unión Europea y otros países. Esta es la documentación completa que acompaña a la autorización de esta vacuna por la FDA (U. S. Food and Drug Administration) y por la EMA (European Medicines Agency).

La vacuna COVID-19 desarrollada por las empresas Pfizer/BioNtech tiene el nombre genérico de Tozinameran (en la International Nonproprietary Names for Pharmaceutical Substances, INN), el nombre comercial de Comirnaty, y el nombre técnico de BNT162b2.

El haber conseguido desarrollar, evaluar y aprobar la vacuna COVID-19 en menos de un año es un triunfo rotundo de la ciencia. Se trata de la primera vacuna autorizada que usa una tecnología distinta: basada en ARN. Y el éxito que vemos ahora es producto tanto de la ciencia básica que lleva investigando sobre vacunas basadas en ARN desde hace muchos años, como de la ciencia aplicada, cuando se invierten recursos formidables, nunca antes movilizados, para reducir el tiempo de evaluación de los ensayos clínicos, aumentando el número de voluntarios involucrados.

La proteína S (de la espícula, en rojo) decora toda la corona del virus SARS-CoV-2 y es la que se ha usado (en forma de ARN) en la primera vacuna aprobada contra la COVID-19 desarrollada por las empresas Pfizer/BioNtech.

El funcionamiento de estas vacunas, basadas en ARN es simple, pero efectivo. El ARN (ácido ribonucleico) es la molécula intermediaria que transporta la información genética entre el ADN (ácido desoxirribonucleico), que está en el núcleo de la célula, y la síntesis de proteínas, que ocurre fuera del núcleo, en el citoplasma de la célula. Se trata de una molécula de ARN mensajero (mRNA) que porta la información codificada para fabricar una de las proteínas del coronavirus SARS-CoV-2, la glicoproteína S (del inglés spike, de la espícula de la corona del virus). Combinada con una mezcla de lípidos se autoorganiza como una nanogota de grasa que envuelve a la molécula de ARN y que es capaz de penetrar en el interior de las células y, una vez en el citoplasma, la información genética que transporta se traduce en forma de la proteína S codificada, usando la maquinaria ribosomal de síntesis de proteínas que tenemos en todas nuestras células. Esa proteína S así fabricada, y fragmentos de la misma, procesados por las enzimas proteasas celulares, son los que acaban exponiéndose en la superficie de la célula vacunada e inducen la respuesta de nuestro sistema inmunitario, que reconoce a estas proteínas como extrañas, no propias, y desata la producción de anticuerpos y de linfocitos contra ella. Se trata de una respuesta policlonal, contra diferentes partes de la proteína S, lo cual garantiza que aunque aparezcan nuevas mutaciones en esta proteína S siempre habrá otras partes de la misma que seguirán siendo diana de la respuesta inmunitaria. Una vez activado el sistema inmunitario por la vacuna COVID-19 la próxima vez que la persona vacunada se vea expuesta al coronavirus SARS-CoV-2 nuestro sistema inmunitario reconocerá la proteína S de su superficie, recordará que tiene anticuerpos y linfocitos contra ella, aumentará la producción de todos ellos y conseguirá inactivar al coronavirus, impidiendo que la infección progrese. Simple pero efectivo. Las estupendas infografías preparadas por los periódicos The New York Times y Materia/El País ilustran perfectamente todo este proceso.

Hasta aquí lo que generalmente sabemos y leemos sobre esta primera vacuna contra la COVID-19. Pero:

  • ¿Qué sabemos de la ciencia que hay detrás de ella?
  • ¿Cuál es la secuencia genética de ARN que se utiliza exactamente?
  • ¿Tiene alguna modificación en relación a la secuencia conocida del coronavirus SARS-CoV-2?
  • ¿Cómo garantizar que el mRNA llegue al interior de las células y se traduzca eficazmente?
  • ¿Cuáles son los lípidos que se usan para mezclarlos con el ARN para constituir la vacuna?

Veamos a continuación todos estos detalles, principalmente los relacionados con la genética de esta primera vacuna contra la COVID-19.

Según el informe de evaluación realizado por la EMA el ARN de la vacuna Comirnaty (Pfizer/BioNtech) se ha preparado a partir de la secuencia de ARN del genoma original del coronavirus SARS-CoV-2, aislado de Wuhan-Hu-1, cuya secuencia completa de 29,903 ribonucleótidos de ARN de cadena sencilla se depositó en GenBank (MN908947.3) y cuya secuencia de aminoácidos codificados de la glicoproteína S corresponde a QHD43416.1.

Mapa del genoma ARN del coronavirus SARS-CoV-2 convertido a ADN, tal y como está almacenado en la base de datos GenBank referencia: MN908947.3. Se indica (en verde) la posición relativa de la secuencia que codifica la glicoproteína S y distintos enzimas de retricción. Mapa obtenido con SnapGene.

A continuación muestro la secuencia original de 3822 ribonucleótidos de ARN de cadena sencilla (ssRNA) que corresponde a la secuencia codificada para la glicoproteína S, en las coordenadas 21563 a 25384, de la secuencia de referencia MN908947.3. Al tratarse de ARN las cuatro bases nitrogenadas son la A, C, G y la U (uracilo), que substituye a la T del ADN.

RNA sequence encoding surface glycoprotein "S" (3,822 ssRNA) Coordinates: 21563..25384

A continuación muestro la secuencia original de 1273 aminoácidos codificados para la glicoproteína S de la secuencia de referencia QHD43416.1. Los aminoácidos K (lisina) y V (valina) en las posiciones 986 y 987 están resaltados en azul e indican las dos posiciones que se mutaron a P (prolina) en la secuencia final del mRNA utilizado, para bloquear la conformación de la proteína S en el estado prefusión con el receptor, con una antigenicidad óptima, de acuerdo a los estudios estructurales realizados por Wrapp y col. (2020).

>QHD43416.1 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2] 1273 aminoacides

En principio alguien podría pensar que ya estaría. Se sintetiza esa molécula de ARN y ya se puede mezclar con los lípidos para generar la vacuna. En realidad no es así. Hacen falta todavía muchas modificaciones para que un fragmento de ARN de la secuencia original que codifica la glicoproteína S se convierta en la vacuna Comirnaty desarrollada por Pfizer/BioNtech y aprobada por la FDA y la EMA.

Para empezar, si usáramos esa molécula de ARN tal cual induciríamos una respuesta celular inmunogénica innata (la célula interpretaría ese ARN como un ARN foráneo) mediada por los receptores de membrana Toll-like TLR3, TLR7 y TLR8 y por los receptores citoplasmáticos inducibles por ácido retinoico RIA, que incrementa los niveles circulantes de Interferón-alfa y que montarían una respuesta inmune contra ese ARN, lo cual sería peligroso y tornaría a la estrategia en inútil para usarla como vacuna. Afortunadamente, la investigación básica realizada anteriormente por Kariko y col. (2008) y por Durbin y col. (2016), entre otros trabajos, demostraron que el uso de nucleósidos modificados existentes en la naturaleza como la pseudouridina o la 1-metil-3′-pseudouridina no inducen esa respuesta inmunogénica contra el ARN. Posteriormente también se comprobó que la 1-metil-3′-pseudouridina, además de todo lo anterior, también aumentaba la capacidad de traducción, gracias a el trabajo de Svitkin et al. (2017), en el que también colaboraron investigadores de la empresa Moderna Therapeutics, la otra empresa que también ha desarrollado otra vacuna COVID-19 basada en ARN, y que también ya ha sido autorizada por la FDA. Por esta razón los investigadores de BioNtech decidieron cambiar todas las uridinas (U) del ARN por 1-metil-3′-pseudouridina (Ψ). Por lo tanto la secuencia original de ARN que codifica la glicoproteína S se convierte en principio a la siguiente:

RNA sequence encoding surface glycoprotein "S" using ᴪ instead of U

Pero todavía no es suficiente. Esta molécula de ARN, a pesar de tener pseudouridinas en lugar de uridinas, todavía sería muy poco estable y hay que añadirle señales de protección en el extremo 5′ (estructura CAP, característica de todos los mRNAs) y una cola de poliadeninas en el extremo 3′, además de otras señales de estabilización y de optimización de la traducción (como el uso de codones optimizados para las células humanas). Hay 20 aminoácidos y 64 posibles combinaciones de 3 letras-ribonucleótidos en el código genético, (incluidas tres señales de paro de traducción), por lo tanto varios codones de ARN codifican para el mismo aminoácido y no todos se usan con igual frecuencia en todas las especies, probablemente relacionado con la abundancia relativa de los t-RNA correspondientes, de ahí la frecuente «optimización» de los codones a la especie que va a traducir el ARN, una aproximación habitual pero no exenta de problemas.

Veamos en esta mapa (obtenido de la WHO-INN) las señales que se le añaden al ARN modificado.

Esquema del mRNA usado por Pfizer/BioNtech para construir la vacuna Comirnaty, basada en ARN. Se indica la estructura CAP añadida en el extremo 5′ y la estructura del análogo de nucleosido usado (1-metil-3′-pseudouridina, Ψ), además de la posición de otras señales de estabilización (5′-UTR, sig., 3′-UTR y polyA). Fuente: WHO/INN

Las señales que se le añaden en el extremo 5′ (izquierda) de la molécula de ARN son:

  • 5′-CAP: Estructura CAP modificada. 5’-cap1 (m7G+m3′-5′-ppp-5′-Am), posiciones 1-2
  • 5′-UTR: Región no traducida en 5′ derivada del ARN del gen de la alfa-globina humana con una secuencia Kozak (de inicio de traducción) optimizada, posiciones 3-54
  • sig: Secuencia que codifica el péptido señal de la glicoproteína S (secuencia extendida de la región líder/inicial) encargada de guiar la traslocación del polipéptido sintetizado hacia el retículo endoplasmático (para que finalmente llegue a exponerse en la membrana citoplasmática de la célula a través de los sistemas membranosos endocelulares: retículo endoplasmático, aparato de golgi y membrana exterior). Esta secuencia ya está originalmente en la glicoproteína S codificada en el genoma del coronavirus, posiciones 55-102
  • S protein_mut: Secuencia de ARN (con codones optimizados, para su mejor capacidad de traducción, de acuerdo a las frecuencias de codones habitualmente usados en células humanas) que codifica la glicoproteína S mutada, con cambios en las posiciones codificadas K986P y V987P, y con dos codones de STOP al final, posiciones 103-3879
  • 3′-UTR: Región no traducida en 3′ que comprende dos secuencias derivadas del mRNA del amino-terminal enhancer of  split (AES) y del RNA 12S ribosomal mitocondrial, que confieren estabilidad al ARN y un aumento en la cantidad total de proteína traducida, posiciones 3880-4174
  • poly(A): Secuencia de 110 ribonucleótidos que conforma la cola poli-A y que consiste en una ristra de 30 residuos de adenosina (A), seguido de una secuencia de unión de 10 ribonucleótidos y de 70 residuos de adenosina (A) adicionales, posiciones 4175-4284

Con todas esas modificaciones incorporadas la secuencia del mRNA final de la vacuna COVID-19 Comirnaty desarrollada por Pfizer/BioNtech (que es bastante distinta al ARN original mostrado anteriormente) corresponde a la siguiente secuencia. En verde se destacan las secuencias 5′-UTR y 3′-UTR. En rojo se destaca la secuencia que codifica el péptido señal que manda la proteína al retículo endoplasmático. Aparecen subrayados dos codones stop ΨGAΨGA. El resto corresponde a la versión optimizada que codifica para la glicoproteína S mutada (con los cambios K986P y V987P, cuya secuencia en el mRNA se destaca en azul).


¿Hay muchas diferencias entre la secuencia de ARN original codificada en el genoma del coronavirus SARS-CoV-2 y la secuencia del mRNA usada en la fabricación de la vacuna contra la COVID-19 Cominarty, desarrollada por Pfizer/BioNtech? Pues sí, hay muchas diferencias, más de 1000 letras cambiadas (exactamente 1061 ribonucleótidos substituidos). Veamos una comparación y alineamiento entre las secuencias del ARN ORIGINAL (en el genoma ARN del coronavirus SARS-CoV-2) y la de mRNA FINAL (en la vacuna COVID-19 Cominarty) realizada con ayuda de la herramienta bioinformática Clustal Omega, de EMBL-EBI. Cada asterisco denota homología (la misma) secuencia. Los espacios resaltan las diferencias, además de las secuencias nuevas añadidas en las regiones 5′ (al principio) y 3′ (al final). El porcentaje de identidad entre las dos moléculas de ARN, original y final, es del 72,24%.


ORIGINAL      ------------------------------------------------------AΨGΨΨΨ	6
              ** ** ** **  *  **** ** ** ** ** ******** ** ** ** ******** 
              **  * ** ** ** ***** **    ** **  * ** ** ** ***** ***** ** 
              *********   **  * ** ** ** ****** ***** * ********   *** ** 
              ** ******** ** ** ** ** ** ** ******** ** ***** ** ** ***** 
              ** ** ** ** ** ** ** ** ** *****   *** ******** ***** ** ***
              ******** ** ** ** **  * **    *********  *** ** ** ** ** ***
              ** ** ** ** ** ** ***** ** ** ** ** ** ** ** ** ** **  **** 
              ** ** ******** ******** ** *********** ****** * ** **    ** 
              ** ** ** ***** ** ** ** ** ** ******** ** ******** ***** ** 
              ***** ** ***** ** **  * ** ** *********** ** ** ** ** ** ** 
              ** **    ******** ***** **  * ***** ***** ******** ** ** ***
               * *****  **** *** **** ** ** ** ********  ******* **  * ** 
              **  * ** ***** **  **** ***** ***         ** ************** 
              ** ***** ******** ** ** ** ***** ** ** **  * ** ** ** ** ** 
              ** ***** ** ** ** ** ** ***** ** ** *****    ** ******** ** 
               **** ******** ** ***** ** ***** ** **    *****  * ** ** ** 
              ** ***** ** **  * ** ** ***** ** **  ******* ** ** ** ** ** 
              ** *********** ** ***** ** ** ****** ***** * ******** ** ** 
              ** ** ** ** ** ** ** ** *****    **   *** ** ***** ** ** ***
              ** ***** **  * ** ** ** ***** ** ** ** ** ** **    ** ** ** 
               * ** ********  * ** ** ** ** ** ** ** ** ***** ** ** ** ** 
              ** **  * ** ** ** ** ** ***** ** ** ** *****    ***** ** ** 
              ** ** ** ** ** ** ** ***********  *  ****  ******* ***** ** 
              ** ** *** * ** ** ** ** ** ************** ***** ******** ** 
              ** ***** ** ** ** ***** **  * ** ** ** ** ** ** ***** ***** 
              ** ** ** ** ** ******** ** ** **    ** ***** ** ***** ** ** 
              ** ** ** ** ***** **    ** *** * ** ** ******** ** ** ******
              ***** **  * ** ***** ** ** ** ** ***   ***** ***** ***** ***
              ** ** ****** * ** ** ** ** ** ** ** ** **  * ***** ******** 
              ** ** ** ***** ** ** **    ** ** ** **   *** ** ** ** ** ** 
              ** **    ** ***** ** ** ** ** ***** ** ***** ** ***** ** ** 
              ** ***** ** ***** ** ** ***** ***** ** ** ** ** **    ***** 
              ***** **  * ** ****** * ** ** ** ** ** ** *****    ** ***** 
              ***** ***** ** ** ** ** ***** ** ** ***** ***** **    ******
               * **  * ** ** ** ** **   *************** ***** ** ** ** ** 
              **    ** ** ***** ** ******** ** ** ***** ** ** ** ** ** ** 
              ******** ** ** ** ***** ***********    ** ** ** ** ******** 
              ** ** ***** ** ** ***  *** **  ** **** ** ***** ** ** ** ** 
               * **  * **  * ** ** ** ** ** ***** ***** *********** ** ** 
              ** ***** ** ** ** ***** ** ** ** ** ** ** ** ** ** ** ***** 
                 ** **  * ** *****    ** ** ****** **   ** ** ** ** ** ** 
              ***************** ** ** ** *********** ** ***** ***** ** ** 
              ** ***** ** ** ** ** ***** ** ** *********** ** ** **  **** 
              *** **** ** ***** ***** ** ** ***** ***** *** * ** ** ******
              **    ** ***** ***** ***** ** **  * ** ** ** *********** ***
              ** **  **** ** ** ** ***** ** ******** ** ** ******** **  **
              ** ******** ** ** ** ** ** ***** ** ** ***   **      *******
              ** ** ** ***** ** ** ** *********** ***** ** **  * ***** ** 
              ** ** ** **   ****** ** ** ** **      ***  * ** ********    
               * ** ***     ****** ** ***** ** ** **  **************** ** 
              **  * ******** ***** ** **  * ** ***** ** ** ** ***** ***** 
              ***** ** ** ** ** ***** ******** ** ** **    ** ***** ** ***
              ** ** ******** ** ** ***  ************ ** ***** ** ** ** ** 
               **** ***** ***** ** ** ***** ***** ***** ** ***** ***** ** 
              ** ** ** ***** ********* * ***** ** ** ** ** ** ***** ** ***
              ** ** *****  **** ** ** ** ** ** ***** ** ** ******** ** ***
              ***** ***** ** ** ** ** ** ***** ***** ** ** ** ** *** **** 
              ** **  * ***   ***** *****  * ** ** ** ******** ** ***   ** 
              ** ** **  * ** ** ***   ** ** *****    ** ** ***** ** ***** 
              ** ***** ** ** ***** ********* * ** **    ** ***** ** ******
              ** ** ***** ******** ** ** ***** ******** ***** ** ***** ** 
              **  ********** ** ***** ***** ***** ** ** ******** ******** 
              ** ** ************   *****   ********* ** ** ** ***** ******
              ** ***** ** ** ** *** * ** ******* *                        
ORIGINAL      ------------------------------------------------------------	3822
FINAL         CGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨC	3960                                                                         

ORIGINAL      ------------------------------------------------------------	3822
ORIGINAL      ------------------------------------------------------------	3822
FINAL         CCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAG	4080                                                                          

ORIGINAL      ------------------------------------------------------------	3822
FINAL         CAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨG	4140                                                                         

ORIGINAL      ------------------------------------------------------------	3822
FINAL         GΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGCAAAAAAAAAAAAAAAAAAAAAAAAAA	4200                                                                       

ORIGINAL      ------------------------------------------------------------	3822
ORIGINAL      ------------------------	3822

A pesar de la gran cantidad de cambios para estabilizar y optimizar la secuencia del ARN mensajero (mRNA) en cuanto a la proteína codificada solamente hay dos cambios, los indicados K986P y V987P. El resto de cambios son silenciosos, se cambia el codón por uno más optimizado para su traducción en células humanas pero el aminoácido codificado sigue siendo el mismo. Todos los demás aminoácidos codificados son los mismos que los que porta el genoma original del coronavirus, como se puede ver en este alineamiento también realizado con Clustal Omega, de EMBL-EBI, entre la glicoproteína S ORIGINAL y la glicoproteína S FINAL (los asteriscos indican que se mantiene la misma secuencia, los espacios indican diferencias entras las secuencias, solamente aparecen las dos Prolinas -PP- casi al final de la proteína final como diferencias). Utilizo el mismo código de colores descrito anteriormente. Las dos proteínas tienen un porcentaje de identidad del 99.84%.


              *************************  *********************************

En este otro artículo, publicado hace dos días, también se analiza la secuencia de ARN de la vacuna COVID-19 Cominarty.

Esquema de una LNP (nanopartícula lipídica) tipo, similar a la usada en el desarrollo de la vacuna COVID-19 por Pfizer/BioNtech. La molécula de ARN mensajero está aquí representado por las bolitas azules del interior de la nanopartícula. Fuente: ATA

Solamente nos queda comentar la mezcla de lípidos que conforman la nanogota que envuelve la molécula de ARN mensajero modificado. El fabricante (Pfizer/BioNtech) habla de LNPs (lipid nanoparticles), nanopartículas lipídicas. Estas LNPs permiten fusionarse con las membranas citoplasmáticas y, a través de la vía endosomal, verter su contenido al interior de la célula, donde el mRNA podrá ser traducido y convertido a la proteína S-mutada (con las dos Prolinas) cuya información genética porta modificada.

Según consta en el Informe de Evaluación de la EMA los componentes lipídicos de estas LNPs son:

  • ALC-0315 (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)
  • ALC-0159 (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide)
  • 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC)
  • colesterol

y, además, la vacuna final contiene las siguientes sales y componentes básicos:  cloruro potásico, fosfato dihidrógeno de potasio, cloruro sódico, fosfato disodio dihidrato, sacarosa y agua, todo ello equilibrado a un pH entre 6.9 y 7.9. Algunos de esos ingredientes lipídicos pueden producir alergia en algunas personas, y por lo tanto, para ellas no estaría indicada la vacunación, como se indica en esta página resumen, a partir de las recomendaciones de la FDA.

Estas LNPs ya habían sido analizadas en estudios pre-clinicos, en animales, y se había verificado que eran adecuadas para administrar y llevar las moléculas de ARN mensajeros con nucleósidos modificados, como describieron Pardi y col. (2015).

Según consta en el Informe de evaluación de la EMA cada persona recibirá una dosis equivalente a 30 microgramos de ARN, encapsuladas en las LNPs en un volumen final inyectable de 0.3 ml por cada una de las dosis. Hay también que recordar que son necesarias dos dosis para llegar al 95% de protección. La segunda dosis se debe administrar 21 días (tres semanas) después de la primera, de acuerdo al informe de la EMA, o como también indican las recomendaciones de la FDA.

Esta vacuna COVID-19 de Pfizer/BioNtech BNT162b2/Cominarty tiene una eficacia del 95% para prevenir la COVID-19 (intervalo de confianza entre 90.3-97.6%). Los ensayos clínicos de fase II/III realizados sobre 36,523 participantes (entre vacunados y placebos) dieron como resultado 8 casos de COVID-19 entre los vacunados y 162 entre los que recibieron placebo, tal y como apareció publicado en la revista NEJM. Inicialmente estas empresas lanzaron dos prototipos de vacunas: BNT162b1 y BNT162b2, con moléculas de ARN mensajero distintas (el primer prototipo portaba informacion genética para un trímero secretable del dominio de unión al receptor, RBD). Sin embargo, tras un estudio piloto, y tras completar los estudios de fase I/II con el primer prototipo BNT162b1, y al observar que las reacciones en personas mayores se observaban en menor cantidad con la segunda versión, se optó por lanzar el ensayo clínico de fase II y fase III solamente con este segundo prototipo; BNT162b2, que finalmente es la que resultó aprobada y es la que será administrada a la población.

Espero que este artículo ayude a comprender la vacuna COVID-19 que nos administrarán durante las próximas semanas o meses. Se trata de una vacuna producto de la ciencia, de mucha ciencia básica (inicialmente desarrollada por muchos grupos, incluidos los investigadores de BioNtech, y luego escalada a nivel global en colaboración con Pfizer) y muchos estudios previos que finalmente en 2020 han servido para completar con rapidez unos ensayos pre-clínicos y clínicos que han demostrado la seguridad y la eficacia de la misma. Por lo tanto, a no ser que pertenezcamos a alguno de los grupos en los cuales la vacunación no está recomendada (p.e. niños menores de 16 años, ser alérgico a alguno de sus componentes, …), lo recomendable, responsable y solidario es vacunarse. Cuando nos toque.

Nota: he grabado un vídeo de divulgación científica de la serie BIOTENTE en el que explico como és la molécula de ARN de esta primera vacuna COVID-19 aprobada en Europa. También referido en una entrada en este blog.

72 Comentarios

      1. El tiempo que durará la protección no lo sabemos, ni para esta vacuna ni para las demás, sencillamente porque todavía no ha pasado «ese tiempo». Para saber si la inmunidad permanece a los 10 meses… tienen que pasar 10 meses tras ser vacunado, cosa que todavía no ha sucedido. Paciencia. Lo sabremos. Tras la aprobación las vacunas entran en la fase IV en la que se realiza un seguimiento a todas las personas vacunadas. Para saber los efectos leves en la salud que puede producir esta vacuna solamente hay que leerse toda la profusa documentación al respecto que hay disponible en la EMA o en la FDA, que cito en el artículo.

        1. Magistral forma de explicar densos conocimientos y contenidos en biología molecular. Espero algún dia tener el privilegio de asistir a una de sus clases!. Saludos desde Venezuela!.

      2. Muchísimas gracias por la labor
        y dedicación. Muy buen artículo.
        Desde un principio se habla de mantenimiento y almacenaje del vial a -78°, ¿qué pasaría si se pierde la cadena de frío? ¿Hasta qué grados y cuánto tiempo, puede BNT162b2, sobrevivir y ser efectiva?
        Muchas gracias, un cordial saludo.

    1. Gracias por tu espectacular lo q se ha conseguido pero tengo una duda razonable..hasta cuando sintetiza proteinas ese mrna? Pasa siempre? Sabemos si su actividad cesara en algun momento? Puede ser que pase años sintetizando proteinas?… eso podria provocar alguna enfermedad de deposito o autoinmune….

      1. Los ARNm seguirán soportando un número determinado ciclo de traducciones hasta que se degraden de forma natural, por eso es un tratamiento vacunal transitorio que desaparece tras algún tiempo, pero tras haber producido la glicoproteína S del coronavirus que, o bien entera o en fragmentos, será presentada en superficie para que sea reconocida por las células del sistema inmunitario. No creo que los investigadores sepan el tiempo exacto que permanece el ARNm activo, pero acabará desapareciendo. Por eso, también, es una estrategia segura.

        1. GRACIAS!! Disculpa mi ignorancia en ciencia basica, soy oftalmologo.. se puede valorar in vitro el tiempo de actividad de ese mrna sintetico? Porque SI lo han dotado geneticamente de mas resistencia que a un mrna natural… a largo plazo una sintesis desbocada de proteinas podria provocar una enfermedad autoinmune o incluso de deposito??
          Gracias de nuevo

          1. El ARN mensajero estára soportando la fabricación de la proteína S durante una serie de ciclos, limitados, y finalmente se degradará y desaparecerá, como cualquier otro ARN mensajero. No se trata de una expresión a largo plazo, es una expresión transitoria.

    2. Gran artículo, Luis. Complejo incluso para los que hemos estudiado alguna vez biología, pero que se puede seguir bastante.
      Tengo una fuerte curiosidad desde hace días: ¿Existe información de cómo es el proceso de fabricación y síntesis de los principios activos, primero a nivel de laboratorio y después (y no menos importante) a nivel industrial?

    3. Excelente y muy detallada explicación para entender el desarrollo de la vacuna contra el Sars-cov2. Años de investigación básica y mucho talento (y dinero) invertido. Nada fácil desarrollar una nueva vacuna. Gracias

          1. Gracias por la información. Muy bien explicado!!
            Una duda, hay alguna posibilidad de que parte de ese material genético pase al núcleo y se introduzca en el adn celular, tipo trasposones?
            Un saludo

    4. Muchas gracias Dr. Montoliúpor esta magnífica explicación. Tengo algunas dudas sobre la respuesta de nuestro organismo y/o el RNAm vírico modificado pueda causarnos daños, me explico: el RNAm vacunas entiendo entraría al igual que el virus en nuestras células que tienen receptores para ello como pulmonares y cardíacas entre otras. Mi primera duda, ¿qué volumen celular estaría afectado?ou otra más preocupante, al igual que la infección viral original, serían destruídas esas células con el RNAm vacunal bien por la replicación de éste intracelular o bien por el ataque inmunitario de nuestro organismo al ser expuestas las espículas virales modificadas por nuestras células? Si fueses así, ¿esta lisis celular podría ocasionar alguna patología? Muchísimas gracias.

      1. El ARNm pude entrar en todas las células del cuerpo, fabrica la proteína S, la presenta y esta es reconocida por el sistema inmunitario que monta la respuesta inmune contra ella.

  1. Extraordinario Lluis, te superas y conjugas datos cientificos avanzados y multitud de enlaces con claridad expositiva. Esperamos las especificaciones sobre el mRNA de Moderna, o lo que te parezca oportuno. Saludos

  2. Un lujo de review, rigurosa y asequible. Muchas gracias por su contínua labor de difusión de la Ciencia, tan útil como necesaria, y.. ¡felices fiestas!

  3. Enhorabuena por la entrada. Aunque el nivel es alto, la idea también puede entenderse por alguien con conocimientos básicos de biología. Gran trabajo. Saludos.

  4. Excelente artículo para mis alumnos de Bioquímica en Medicina. Si son capaces de entenderlo, es que han comprendido los temas de transcripción y traducción. Y señala la gran importancia de la ciencia básica. Muchísimas gracias.

  5. Un artículo que aclara muchos aspectos de la vacuna y que sin duda me voy a releer.

    Al ser un tema desconocido para mí estoy haciendo un importante esfuerzo en comprender todo lo relativo a las diferentes vacunas, tiendo a interesarme más por las vacunas que no emplean el ARN y soy consciente de que probablemente la base de mi preferencia es la inercia o la ignorancia.

    Estaba también muy preocupada de cara a la vacunación de mis hijos y veo que no se recomienda la administración de esta vacuna a niños menores de 16 años., ¿Cual es el motivo? ¿Podría recomendarme alguna lectura?

    Gracias por poner luz en un tema tan complejo para que los que no controlamos del tema podamos ir entendiendo.

    1. Lo mejor es leer los análisis e informes facilitados por la FDA y por la EMA, que cito en mi artículo. En relación a los menores de 16 años no se recomienda porque simplemente este grupo de población no había sido incluido en los ensayos clínicos y, por precaución, mientras no tengamos datos de cómo responde esta vacuna con ellos, por eso se recomienda no vacunar. Cuando se obtengan más datos podrá actualizarse esta indicación.

  6. Un excelente artículo, de los mas completos. Iba a preguntar algo, pero me reservo la pregunta para dentro de 18 meses. Creo que hay un video del autor en «El Confidencial», junto al Dr.Estanislao Nistal.

  7. Excelentes y detalladas explicaciones. Ojalá se invirtiesen tantos esfuerzos y recursos para paliar otras enfermedades de países menos desarrollados y el hambre en el mundo, de las que mueren y se ven afectados innumerables muchas más personas que por este virus. Deberíamos reflexionar como humanidad de qué manera se distribuye la asignación de recursos para mejorar la salud global.

  8. Estupendo artículo!!, me gustaría saber más sobre los nucleosidos naturales modificados y si estos, entiendo que no, son reconocidos sin problemas para la fabricación de la proteína. ¿Nuestra maquinaria enzimàtica no es tan específica entonces.?

    Muchas Gracias

  9. Hola Lluis, mil gracias por tu artículo que sin duda tendré que releer. Te pregunto lo siguiente porque lo estoy leyendo mucho últimamente en publicaciones de personas que están haciendo lo imposible por convencer de NO vacunarse.

    ¿Que nos puedes decir sobre el riesgo a medio/largo plazo las actuales vacunas respecto a la llamada «Mejora de la dependencia de los anticuerpos» (ADE) que haría el efecto contrario con anticuerpos no neutralizantes y agravaría la enfermedad? ¿Es un riesgo real?

    Muchas gracias.

  10. Excelente explicación. solo comentar una cosa:
    «Se trata de una respuesta policlonal, contra diferentes partes de la proteína S, lo cual garantiza que aunque aparezcan nuevas mutaciones en esta proteína S siempre habrá otras partes de la misma que seguirán siendo diana de la respuesta inmunitaria».
    Esta afirmación no es del todo cierta. Que se desarrollen anticuerpos policlonales frente a varias partes de la proteína S no garantiza que si se produce una mutación en la proteína S del virus, estos anticuerpos sean terapéuticos y puedan actuar frente a otras partes de la proteína. Aunque otros anticuerpos sean diana de otras partes de la proteína puede que estos no sean neutralizantes, y en ese caso no serían efectivos. Por este motivo es peligroso que aparezcan mutaciones en la proteìna S del virus ya que no todas las partes de la proteína S generan anticuerpos «buenos». Los anticuerpos efectivos serían los anticuerpos monoclonales frente a fracciones de la proteína S esenciales para su unión a la célula diana, como por ejemplo el dominio RBD. Es por esto que cada vez que se describe una mutación en la proteína S del virus se lleva a cabo un estudio para determinar si se ha alterado alguno de los epítopos (zonas de unión a anticuerpo) que desencadena la síntesis de anticuerpos neutralizantes. Muchas gracias por su artículo.

  11. Excelente, excelente, excelente. Muy divulgativo sin perder rigor.
    Mi pregunta es más en clave inmunológica. Una vez la proteína S sintetizada y expuesta en la membrana celular, se desencadena una respuesta humoral y celular supongo. Eso quiere decir que se expandirán los clones de linfocitos T que porten receptores específicos frente a los epitopos de la proteína S, unos se citodiferenciarán hacia Tc memoria y otros hacia Tc efectores. Mi pregunta es: esos T efectores provocan la lisis de la célula que expresa en su membrana la proteína S?.
    Muchas gracias y enhorabuena por su magnífico artículo.
    Federico Zurita

  12. Enhorabuena Lluis por tu fantástico y bien detallado artículo. He aprendido y disfrutado mucho leyéndolo. Me surge una duda y me gustaría planteártela:

    Según indicas, para evitar una respuesta inmunogénica innata de la célula al interpretar ese ARN como foráneo, se han modificado los nucleósidos uridina por pseudouridina o 1-metil-3′-pseudouridina que no inducen respuesta inmune. Seguramente me estaré perdiendo algún detalle, pero mi pregunta es ¿por qué cuando el virus inserta su ARN con uridina original es capaz de que los ribosomas celulares lo lean y fabriquen la proteína S y el resto de componentes de los viriones sin que la célula infectada responda a ese ARN foráneo?

    Muchas gracias.

    1. Hola Jesús, el genoma del coronavirus no entra en la célula por la misma ruta que la vacuna, está ya protegido en los extremos 5’ y 3’ y contiene otras proteínas y secuencias ARN que ayudan en el proceso de la replicación y traducción, por eso en su caso la U no es un problema.

  13. Muchísimas gracias por esta entrada profesor Montoliu.

    Le planteo las siguientes dudas:

    A nivel del funcionamiento normal de una célula, ¿existe la posibilidad de que el ARNm codificante de cualquier proteína celular se retrotranscriba a ADN y que éste se integre en el genoma celular?. Si esto es posible, ¿podría ocurrir lo mismo con el ARN viral que penetra en la célula en caso de infección, y con el ARNm vacunal?

    ¿Se conoce cómo afecta el ARN interferente (ARNsi, ARNmi) a la expresión del ARNm vacunal?

    1. El ARNm que contienen las vacunas COVID-19 no se retrotranscribe (y tampoco se integra en el ADN), apenas sirve para un número limitado de ciclos de traducción y luego desaparece.

  14. Muchas gracias por esta magnifica entrada.

    Le quería trasladar las siguientes preguntas:

    Ya que algunos pseudogenes se generan por retrotranscripción de ARN mensajeros celulares, ¿es posible que se retrotranscriban ARNmensajeros de cualquier tipo de virus (tanto ADN como ARN)?

    ¿Es posible la retrotranscripción del ARNm vacunal?

    ¿Cuál es la localización de estas retrotranscriptasas celulares, nuclear o citoplasmática?

    ¿Cómo afectan los ARN interferentes (miRNA, siRNA) a la traducción del ARN mensajero vacunal?

    Muchas gracias

    1. El genoma del coronavirus no se retrotranscribe ni inserta en el genoma de la célula infectada. El ARNm que portan las vacunas COVID-19 no se retrotranscribe ni inserta en el genoma de la célula en la que entra vía LNPs.

  15. Ya que en el genoma humano existen retrotransposones de clase I (estructuralmente semejantes a los retrovirus), y retrotransposones de clase II (secuencias LINEs=elementos nucleares dispersos largos, que constituyen un 20% del genoma humano) que codifican su propia transcriptasa inversa, y sabiendo que esta enzima, aparte de participar en la transposición de los retrotransposones, también retrotrancribe ARN de transferencia para generar secuencias SINEs (elementos nucleares dispersos cortos, que constituyen el 10% del genoma humano), y ARN mensajero para generar pseudogenes procesados, ¿puede esta transcriptasa inversa celular retrotranscribir ARNs virales procedentes tanto de virus ARN como de virus ADN?, ¿pueden las secuencias de ADNc generadas por esta retrotranscripción insertarse en el genoma celular?. Si esto fuera posible cualquier virus, no solo aquellos que integran su genoma completo en el genoma celular (retrovirus, herpesvirus), podría desencadenar la introducción de modificaciones en el ADN celular, pues todos los virus utilizan de una forma o de otra la molécula de ARN.

    ¿Podría ocurrir esto con ARN de otros agentes infecciosos, por ejemplo bacterias intracelulares (clamidias, rickettsias), protozoos intracelulares (Toxoplasma, Plasmodium)?

    ¿Pueden las células captar fragmentos de ADN o de ARN directamente del medio extracelular?, ¿este ARN extraño podría retrotranscribirse y, posteriormente, el ADNc generado insertarse en el genoma celular?, ¿este ADN extraño podría insertarse en el genoma celular?

    ¿Podría ser esta la base de la asociación de enfermedades autoinmunes y enfermedades tumorales con determinadas infecciones?

    ¿Puede ocurrir esta retrotranscripción de ARNs virales cuando se administran vacunas de virus atenuados o inactivados?

    ¿Puede pasar esto con el ARN mensajero que se está empleando en algunas vacunas contra la COVID-19?

  16. Para evitar que las células humanas detecten y eliminen el RNA de la vacuna dicho RNA ha sido modificado con pseudouracilo, etc.
    Como se las arregla el virus para traducir su RNA nativo -no modificado-? No es detectado y eliminado por la célula infectada?
    Maravillosas explicaciones. Gran comunicador.

    1. El coronavirus tiene otras estrategias moleculares que garantizan la replicación, procesamiento y traducción de su ARN no modificado (sin pseudouracilo) que son extraordinariamente eficientes y producto de millones de años de selección natural.

  17. La exposición me ha parecido magnífica!!. Me llegó a través de las redes sociales el video de divulgación científica BIOTENTE y me pareció preciosa y formidable la explicación. Muchísimas gracias por su aporte divulgativo y con tanto rigor científico a su vez sobre esta nueva vacuna.
    Me surgen unas preguntas y es en qué células se va a expresar esas proteína sintetizada?, cabe la posibilidad que si durante un tiempo prolongado no pare el organismo de sintetizar esa proteína puedan desencadenarse ciertas enfermedades autoinmunes?

    1. El ARNm de las vacunas COVID-19 sirve para un número limitado de ciclos de traducción, tras los cuales desaparece, y con él la capacidad de producir más proteína S, que, por lo tanto no perdura demasiado en el tiempo. No hay peligro de sobreexpresión de la proteína S.

  18. Enhorabuena por el artículo, es muy técnico pero al mismo tiempo permite a los no expertos en la materia informarnos con rigor. Oigo voces que hablan de que la vacuna de Pfizer implicará revacunarse obligatoriamente cada 1 ó 2 años, ya de por vida. Que no hay vuelta atrás, uno no podrá decidir dejar de vacunarse y que tampoco se podrá cambiar de vacuna si se ha empezado con la de pfizer. Leyendo su artículo me parecen afirmaciones totalmente infundadas, cuál es su opinión?

    1. Nada sabemos de cuánto van a durar las protecciones contra la COVID-19 de estas vacunas, más allá de los pocos meses documentados hasta el momento. Habrá que esperar a que pase el tiempo para poder contestar a ello. Sobre la revacunación creo que es prematuro e imprudente comentar nada sin tener los datos que necesitamos cuando haya pasado ese tiempo. Lo lógico es completar el protocolo de vacunación de un tipo de vacuna correctamente, tal y como indican las autorizaciones por las que se aprueba su uso.

  19. Hola Lluis,
    Gracias por tu continua labor de divulgación. Me queda una duda que quizás tu sepas. Es respecto a la especificidad del liposoma. ¿ Es posible dirigirlo únicamente contra las células presentadoras de antígeno o las dendríticas ?. Si no es así, ¿ que impide que el sistema inmunitario reconozca otros tipos celulares que exhiban la proteína S ? Gracias.

    1. Gracias Jero. Las LNPs pueden contener péptidos que las dirijan a determinadas células que contengan receptores para esos péptidos, pero no es el caso en estas vacunas COVID-19. En principio muchas células expresarán la proteína S en superficie y estas serán reconocidas como extrañas por las células del sistema inmunitario y montarán la respuesta contra ella.

Deja un comentario

Este sitio usa Akismet para reducir el spam. Aprende cómo se procesan los datos de tus comentarios.